rs8137058 chr22:35548727 G>A
- Sequence
gctccaccccgagttttggagaag[G/A]ggcatgtagataggagagccctgg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.06 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, paternal transmission distortion, suicide attempts in bipolar disorder (females)
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg