rs8137780 chr22:38927257 G>C
- Sequence
cccggctcgtggcgcgagcctggt[G/C]ccacccgggcggtggtgggagtgt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM19240 (B cells Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.64 | 0.95 | 1.43 | n/a | n/a |
Items per page:
1 – 1 of 1