rs814941 chr1:190497692 G>A
- Sequence
tccttgtgcatgtaacaaaatgtg[G/A]cttactgattgccaaccccagagt
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.31 | 1.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, maternal transmission distortion, paternal transmission distortion, spine bone mineral density (bmd), transmission distortion, triglycerides change with statins