rs815324 chr1:110496218 T>C
- Sequence
aatctcagatgccagctttgtaca[T/C]cttgtttatatcctgtaacatttc
- ASB in cell types
- HEK293 (embryonic kidney) erythroid cells GM12878 (female B-cells lymphoblastoid cell line) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.06 | 0.93 | 1.93 | |||
| erythroid cells | n/a | 3.38 | 3.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 3.05 | n/a | 3.00 | |||
| epidermal keratinocytes | 1.76 | -0.35 | 2.00 | |||
| neural cell | -0.30 | 0.52 | 1.00 |
Items per page:
1 – 5 of 7