rs816951 chr20:64055815 T>C
- Sequence
cgcggcgggagcctggccaaggtt[T/C]gctctcagaccccatctggctgcc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 2.08 | 0.12 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Lung, Skin_Sun_Exposed_Lower_leg