rs816957 chr20:64058256 T>C
- Sequence
tgaaccaggccaccagtgacccca[T/C]ccacacctgtccgaccaggctccc
- ASB in cell types
- pancreas GM17942 (lymphoblastoid cell) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | n/a | 2.58 | 1.50 | |||
| GM17942 (lymphoblastoid cell) | 2.17 | n/a | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.10 | 0.89 | 2.25 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood