rs8176070 chr5:60541649 G>A
- Sequence
atccctcccgcccaccatccccca[G/A]cctgtgaaccaatttgtttgaaga
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.54 | -0.24 | 2.00 | n/a | No Hit | |||
| EP300_HUMAN | -0.25 | 1.57 | 1.12 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Testis, Thyroid, Whole_Blood