rs8177826 chr7:44796669 C>G
- Sequence
cgtggtataaaaggggcgggaggc[C/G]aggctcgtgccgttttgcagacgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line) monocytes from periferal blood HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- SRBP2_HUMAN CLOCK_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 1.90 | -4.47 | 2.50 | n/a | No Hit | |||
| CLOCK_HUMAN | 2.13 | -4.40 | 2.00 | 0.37 | Weak Discordant | |||
| PKNX1_HUMAN | 0.38 | -0.07 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood