rs8181664 chr12:58907 A>G
- Sequence
ctaccaacaagccagcactacaag[A/G]actgctaaaagtagttataaatct
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) HDF(human dermal fibroblasts)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -1.06 | 1.84 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1