rs8181769 chr12:22632168 G>A
- Sequence
ctgagaaaataataagtgcatgaa[G/A]gtctttgtacaggaaaccgtatga
- ASB in cell types
- spleen Peyer's patch LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | -1.82 | 2.22 | 1.00 | |||
| Peyer's patch | -1.57 | 1.97 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.64 | -0.46 | 1.00 |
Items per page:
1 – 3 of 3