rs8183987 chr20:5819407 A>G
- Sequence
tccaaactttgcttattaactgta[A/G]tgtttgcctttgtaattgcttcac
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.49 | 2.26 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.71 | -1.13 | 1.00 | |||
| glioblastoma patient-derived cell model | 2.41 | -2.11 | 1.00 |
Items per page:
1 – 3 of 3