rs8185 chr14:74942086 T>C
- Sequence
agggggggcagggtggtggcacct[T/C]ggccggaaagaacaatgtcccagt
- ASB in cell types
- BJAB (Burkitt lymphoma)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | 3.08 | -3.42 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, college completion, fasting blood glucose, hdl cholesterol change with statins, homa-ir, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Muscle_Skeletal