rs818619 chr7:105532058 A>T
- Sequence
agcgaatcccttctctggagctcc[A/T]taggggagggtgcccgcttcctga
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) adult erythroblasts CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN STAG1_HUMAN SMCA4_HUMAN HCFC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.75 | -0.11 | 2.60 | n/a | No Hit | |||
| STAG1_HUMAN | 0.13 | 1.39 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | 1.05 | 0.15 | 1.22 | n/a | n/a | |||
| HCFC1_HUMAN | 1.73 | 0.28 | 1.50 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid