rs818620 chr7:105532238 G>C
- Sequence
ctacggcctccgaggctgggtagt[G/C]agtgtgtcgctggccttagccaga
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) adult erythroblasts CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TBP_HUMAN STAT1_HUMAN HCFC1_HUMAN E4F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | -0.49 | 1.43 | 1.33 | n/a | No Hit | |||
| STAT1_HUMAN | 1.65 | 0.13 | 2.50 | n/a | No Hit | |||
| HCFC1_HUMAN | 2.50 | -0.04 | 1.50 | n/a | n/a | |||
| E4F1_HUMAN | 1.50 | -1.13 | 1.17 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, prop taste detection threshold, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid