rs8192725 chr19:40848807 A>G
- Sequence
aatggagacaggccagggggcggc[A/G]ggggcaggagcggagcagctccaa
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.95 | 0.04 | 1.92 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Esophagus_Muscularis, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood