rs820965 chr2:57517184 T>C
- Sequence
ggaaatgttatcagtttacccttg[T/C]gggaggttaaacaattatagattc
- ASB in cell types
- SK-N-SH (neuroblastoma) VCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.21 | 0.58 | 1.18 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, aortic valve calcium, cystatin c in serum, primary rhegmatogenous retinal detachment, rheumatoid arthritis, spine bone mineral density (bmd)