rs822349 chr9:5442487 C>T
- Sequence
ttaaaccattctgggatggtgctc[C/T]ccaaattctggattttaaccttca
- ASB in cell types
- foreskin keratinocyte Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -3.79 | 1.27 | 2.17 | |||
| Peyer's patch | -0.08 | 1.73 | 1.00 |
Items per page:
1 – 2 of 2