rs823374 chr7:29610031 C>G
- Sequence
aatgtttggttttgtaaatatatt[C/G]ttcttccatggcatggcagtccct
- ASB in cell types
- IPSC-derived bipolar neuron RWPE2 bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | 2.31 | -0.17 | 1.00 | |||
| RWPE2 | -1.62 | 1.89 | 1.00 | |||
| bipolar neuron | 1.31 | 0.31 | 1.00 |
Items per page:
1 – 3 of 3