rs826723 chr12:130047657 G>A
- Sequence
ccccactgaccacaaaccaacaca[G/A]ggcctccaaacggggccccaaccc
- ASB in cell types
- H929 (plasma cell myeloma) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 1.87 | -1.55 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.57 | -0.47 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, bipolar disorder, hdl cholesterol change with statins, maternal transmission distortion, salmonella-induced pyroptosis