rs830718 chr16:12228951 C>T
- Sequence
ctccaccgagtcttctgactcctg[C/T]tgctctccctaagtgagtgtctag
- ASB in cell types
- neural cell HCAEC (human coronary artery endothelial cells) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.22 | -0.72 | 1.00 | |||
| HCAEC (human coronary artery endothelial cells) | 1.45 | -0.64 | 1.00 | |||
| epidermal keratinocytes | 1.53 | -0.59 | 2.00 |
Items per page:
1 – 3 of 3