rs833069 chr6:43774842 T>C
- Sequence
gagggctcagcctaatgggatctc[T/C]cctcccttccctggtttgcattcc
- ASB in cell types
- K562 (myelogenous leukemia) ascending aorta KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.35 | 1.14 | 2.95 | |||
| ascending aorta | n/a | 3.07 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | -0.09 | 2.04 | 2.00 |
Items per page:
1 – 3 of 3