rs833910 chr19:37987640 C>T
- Sequence
tccctagttggttaccagcggcct[C/T]gcaccctctaatttcaccatgcct
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.81 | 3.14 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 2.62 | -1.06 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 2.39 | -0.73 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -1.24 | 2.60 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.10 | -0.58 | 1.00 |
Items per page:
1 – 5 of 6