rs835087 chr5:14972914 C>T
- Sequence
ccttataatttctccattcagtgg[C/T]tgacaggactttgtgaccatgtga
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.95 | -1.91 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, college completion, ldl cholesterol, major depressive disorder, simpson-angus scale, type 1 diabetes