rs837127 chr15:36951985 G>T
- Sequence
agtcagtaatttgcatcctatgag[G/T]ctgctttggtcactcacactcatt
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
- ASB for transcription factors
- HXC5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXC5_HUMAN | -4.93 | 2.83 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, fasting blood glucose, fasting insulin, homa-ir, microalbuminuria, years of education