rs837481 chr12:124545651 C>T
- Sequence
aggcgttcagaagcccaagtggcc[C/T]ggctggggtcagggccctgagtca
- ASB in cell types
- CAR-T cells
- ASB for transcription factors
- IRF4_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | 2.52 | -0.89 | 1.33 | n/a | No Hit | |||
| STAG1_HUMAN | 1.10 | -0.15 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins