rs838441 chr2:231706504 A>G
- Sequence
acccgacaaagagttgagacgcgt[A/G]gtcctcgggaacagcactgtggaa
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) HepG2 (hepatoblastoma) renal cortex
- ASB for transcription factors
- TYY1_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | n/a | 2.20 | 3.00 | n/a | No Hit | |||
| CREB1_HUMAN | 1.90 | -1.60 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2