rs839026 chr4:57427071 C>T
- Sequence
ctgaagaatcacctcatctctccc[C/T]gcagagagcacagagcacaggact
- ASB in cell types
- foreskin keratinocyte IPSC-derived bipolar neuron GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.82 | 0.54 | 1.25 | 0.39 | Weak Discordant | |||
| STAG1_HUMAN | 0.58 | -0.17 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
