rs840105 chr10:115402977 G>A
- Sequence
tgatacattttgagaaatgttgcc[G/A]taggaggatcttcctgaacatttt
- ASB in cell types
- HS-ES-2M (Epithelioid sarcoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 2.23 | 0.28 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Stomach, Thyroid