rs841718 chr12:57099213 G>A
- Sequence
tagggagtgacatcaggatgacac[G/A]cgggcagggagaggagggcagcgg
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.73 | 0.39 | 1.88 | |||
| monocyte-derived dendritic cells | 0.66 | 1.37 | 1.12 |
Items per page:
1 – 2 of 2