rs842072 chr2:158969125 G>T
- Sequence
gcttggggcacgctcgagttctgg[G/T]accacccccgcccggcgcgcccgc
- ASB in cell types
- HEK293 (embryonic kidney) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.43 | 0.86 | 1.07 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -2.02 | 1.85 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid