rs848108 chr14:36767924 T>C
- Sequence
tttggatctgaagttttaaccctt[T/C]ttgactggacatctggccctgcaa
- ASB in cell types
- HEK293 (embryonic kidney) SMMC-7721 (hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.33 | 0.86 | 1.55 | |||
| SMMC-7721 (hepatocellular carcinoma) | n/a | 2.14 | 2.00 |
Items per page:
1 – 2 of 2