rs849013 chr6:11732554 G>A
- Sequence
tgagctcctctaaccagggcgtga[G/A]cagaaatagagatgcttccatcaa
- ASB in cell types
- MDM(monocyte derived macrophages) NOMO-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.17 | 1.99 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, diastolic blood pressure (dbp), major depressive disorder, microalbuminuria, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio