rs849924 chr7:29450032 G>A
- Sequence
cttccaggatcttccctaggggat[G/A]tggtacaggtttaagaaattcagg
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.04 | 0.77 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diabetic nephropathy in type 1 diabetes, microalbuminuria, refractive error, serum creatinine, triglycerides change with statins