rs850577 chr6:96917363 A>C
- Sequence
aaatggttcccctggagactcata[A/C]cctgtagtcctcagaccagaaaag
- ASB in cell types
- K562 (myelogenous leukemia) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.12 | 1.97 | |||
| macrophages form periferal blood | 0.36 | 2.36 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), hdl cholesterol, height, hip bone mineral density (bmd), partial epilepsy, systolic blood pressure (sbp)