rs852817 chr12:21698049 T>C
- Sequence
gtgataacctattcattcatttct[T/C]tctcttttttttttttttttaatc
- ASB in cell types
- hepatocytes SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | 1.43 | -0.71 | 1.00 | |||
| SK-N-SH (neuroblastoma) | 0.98 | 0.01 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol, homa-b, homa-ir, ldl cholesterol, total cholesterol, triglycerides change with statins