rs855619 chr19:38074273 T>A
- Sequence
gacgaaggcctgcaagaacatctg[T/A]gtgtgtgcacagaagggagcagaa
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma)
- ASB for transcription factors
- MYOD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYOD1_HUMAN | 1.99 | -0.06 | 1.17 | -1.69 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid