rs855919 chr7:149497080 G>C
- Sequence
accccgggaagctgggcacgtagt[G/C]ggagtcggtgtatgcggattcgaa
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.02 | 0.51 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.07 | 0.18 | 1.01 |
Items per page:
1 – 2 of 2