rs858423 chr19:5048363 T>C
- Sequence
agtgtgagtatgcatgcgtgtgtg[T/C]gcccctgtgtcaccgggctctgct
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts HEK293 (embryonic kidney) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.77 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | -1.22 | 2.32 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.72 | 0.17 | 1.96 | |||
| hepatocytes | -0.50 | 1.29 | 1.00 |
Items per page:
1 – 4 of 4