rs860214 chr2:64767769 T>C
- Sequence
agggatacacaaaattgaattctt[T/C]ccgatcattgtgtattagcatctc
- ASB in cell types
- K562 (myelogenous leukemia) RPMI8226 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.83 | 0.26 | 1.99 | |||
| RPMI8226 (Plasma cell myeloma) | -1.55 | 1.89 | 3.00 |
Items per page:
1 – 2 of 2