rs862968 chr14:26008520 T>A
- Sequence
ggaaaagacattgcttgtctgact[T/A]ataagattaggaaagtgcagacac
- ASB in cell types
- Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 1.84 | -1.13 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, ldl cholesterol change with statins, total cholesterol, years of education