rs863002 chr1:159205130 C>T
- Sequence
tcttccttcaaagtctttttcctt[C/T]tctccttcctatgctagcctccta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.74 | -4.44 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, fasting insulin, fasting serum mcp-1 (pg/ml) in children, homa-ir, hypertension (early onset hypertension), monocyte chemoattractant protein-1 in obese children, monocyte count, total serum ige, variant creutzfeldt-jakob disease, years of education