rs863007 chr1:159211807 G>T
- Sequence
ggtgtataattaatttcatttaaa[G/T]aatttgttgagtatccactacatt
- ASB in cell types
- A549 (lung carcinoma) THP-1 (acute monocytic leukemia) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.01 | 0.89 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 1.25 | 0.16 | 2.00 | |||
| MM1.S (plasma cell myeloma) | 1.51 | -0.41 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood