rs864234 chr17:75667233 C>A
- Sequence
gcgagcgctggcatgagggcggag[C/A]caggcgcaggaaactgccgttttg
- ASB in cell types
- K562 (myelogenous leukemia) VCaP (prostate carcinoma) SK-N-SH (neuroblastoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MEF2B_HUMAN EMSY_HUMAN SUMO2_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 3.56 | -0.39 | 1.75 | n/a | No Hit | |||
| EMSY_HUMAN | 0.54 | n/a | 2.00 | n/a | n/a | |||
| SUMO2_HUMAN | 2.50 | -1.19 | 1.67 | n/a | n/a | |||
| NR2C1_HUMAN | -2.46 | 2.12 | 1.83 | n/a | No Hit | |||
| GABPA_HUMAN | 2.12 | 0.77 | 2.22 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood