rs866730 chr6:43724136 T>C
- Sequence
cagttctggggagaaggattggga[T/C]tggactcacgcagtgggaggtagc
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -1.01 | 1.34 | 1.00 | |||
| A549 (lung carcinoma) | 1.47 | 0.50 | 1.00 |
Items per page:
1 – 2 of 2