rs867311 chr2:111920393 G>T
- Sequence
gcactgactcagagccagccaccc[G/T]ctttctcttgcagggctttgctac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HepG2 (hepatoblastoma) MDM(monocyte derived macrophages) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- TF65_HUMAN NOTC1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.49 | n/a | 2.00 | n/a | No Hit | |||
| NOTC1_HUMAN | 2.74 | -4.97 | 2.00 | n/a | n/a | |||
| ANDR_HUMAN | 1.81 | -1.10 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Stomach, Testis, Thyroid, Whole_Blood