rs867380 chr4:99530360 C>T
- Sequence
caacattcatctcttcctcttttc[C/T]ttgcaaaactatgtcttcaaactt
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | -1.33 | 1.87 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, homa-b, homa-ir, ldl cholesterol, serum creatinine, total cholesterol, waist circumference in type 2 diabetes, waist hip ratio, weight in type 2 diabetes