rs867563 chr2:136384930 A>G
- Sequence
ctctgagccaaacctataaatctc[A/G]ggaacatctacaagaactgttttc
- ASB in cell types
- Peyer's patch sigmoid colon neural cell LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 0.06 | 1.60 | 1.00 | |||
| sigmoid colon | -0.40 | 2.42 | 1.00 | |||
| neural cell | 1.03 | -0.43 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.50 | -1.10 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.25 | 0.71 | 1.00 |
Items per page:
1 – 5 of 6