rs867755 chr5:177431048 C>T
- Sequence
ggagcctcccctgagaccttgccc[C/T]ggagcagaggggcagacttggggg
- ASB in cell types
- germinal center CD77+ B cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center CD77+ B cells | 2.27 | -1.33 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, college completion, factor xii antigen, ldl cholesterol, total cholesterol, triglycerides, years of education
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood