rs867921 chr1:156383183 T>C
- Sequence
ctcaggctgaggcctagaagggga[T/C]ggctgcgccatgtggggcagggac
- ASB in cell types
- WA09 (embryonic stem cells) MDA-MB-453 (breast adenocarcinoma) WA01 (H1, human embryonic stem cells) ovary
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.79 | 0.41 | 1.38 | |||
| MDA-MB-453 (breast adenocarcinoma) | n/a | 2.55 | 2.00 | |||
| WA01 (H1, human embryonic stem cells) | 1.38 | 0.75 | 1.18 | |||
| ovary | -2.34 | 2.29 | 1.00 |
Items per page:
1 – 4 of 4