rs869363 chr8:46029497 G>T
- Sequence
tcaagctctgactcccagatggcg[G/T]tgctagagctctggcgagactggg
- ASB in cell types
- T47D (invasive ductal carcinoma) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.12 | 0.55 | 1.02 | |||
| RWPE2 | -1.85 | 2.24 | 1.00 |
Items per page:
1 – 2 of 2